King Claudius is one of the most interesting characters Essay Example for Free

King Claudius is one of the most interesting characters EssayKing Claudius is one of the most interesting characters in William Shakespeares play, Hamlet. He is a man who is always preoccupied with maintaining his own power, rather than protecting his country, Denmark, from danger. Act IV is one of the most significant acts in Hamlet as it shows us how Claudius really thinks. In this act, we get a taste of Claudiuss malevolent taste and his obsession with power. Claudius is thus one of the more significant characters in this act, as this is where we see how his mind plays and how he goes to peaks to regain his control over his people and the events that have recently occurred. One of the ways that Claudius maintains his power is by victimisation other people to his own advantage, namely Rosencrantz and Guildenstern. Rosencrantz and Guildenstern are two indistinguishable courtiers who obey the Claudiuss every command. Claudius besides uses them as his own personal spies, which is another honorable example of how he uses them to his own advantage. Hamlet reflects upon this in one of the best quotes in the play that properly describe Rosencrantz and Guildenstern Besides, to be demanded a sponge that soaks up the kings countenance, his rewards, his authorities when he needs what you have gleaned, it is but squeezing you, and, sponge, you shall be dry again.1 In this quote, Hamlet describes Rosencrantz and Guildenstern as sponges. This is quite a good comparison since sponges soak up water and therefore are re-used once they are squeezed, while Rosencrantz and Guildenstern gather up vital information for the king and then are re-used once their information is shared with the king. Another example of how Claudius attempts to regain control over the affairs occurring in Denmark is when Polonius is murdered by Hamlet.When Claudius hears about the murder, he begins to think politically in the way that the murder might ruin his kingship. He realizes that to solve this issue without threatening his position would require much work and skill We must(prenominal), with all our majesty and skill, / Both countenance and excuse. 2 Claudius, realizing that Hamlets original intent was actually to murder him3, decides to send Hamlet immediately to England in trust that the English king would murder him under Claudiuss request.This can be considered as a good example of how Claudius is obsessed with maintaining his political power. Since Claudius is now aware of Hamlets despiteful state, sending Hamlet to England may be considered as a good way to keep Hamlet away from Claudius. Another good reason to why Claudius sends Hamlet to be murdered in England and not in Denmark is because of fear of losing his political power. If Claudius decides to kill Hamlet, twain Gertrude and the people of Denmark will hate him as they both love Hamlet very much, and thus, his kingship will be at stake.Yet must not we put the strong law on him Hes loved of the confuse multitude, Who like not in their judgment, but their eyes And where tis so, the offenders scourge is weighd But never the offence. To bear all smooth and even, This sudden sending him away must seem Deliberate pause 4 Another example of how Claudius regains his control over the events occurring in this act is when Laertes returns demanding to know who had killed his father. Claudius does not tell Laertes the culprit in front of Gertrude, fearing that she would turn against him.Instead, he decides to tell Laertes behind her back. It is at this time that Claudius and Laertes are informed that pirates have returned Hamlet to Denmark, this gives Claudius a chance to strike a deal with Laertes If Claudius lets Laertes kill Hamlet, then Laertes will be under Claudiuss command. This is a bigger advantage for Claudius as it gets rid of Hamlet without affecting his kingship, and it keeps Laertes under his command.My lord, I will be ruled The rather, if you could devise it so That I might be the organ. 5 Claudius thinks up a foolproof plan to murder Hamlet. He suggests that a fencing match be held between Laertes and Hamlet, with the exception of a sharpened sword given to Laertes rather than a blunt sword. He also adds that if Hamlet were to win, Claudius would give him a poisoned drink as congratulations to his victory. And he calls for drink, Ill have prepared him A chalice for the nonce wherepon but sipping, If he by chance escape your venomd stuck, Our purpose may hold here. 6.This particular scene is extremely significant as it shows the reader how truly malevolent Claudius is and how furthest he would go to maintain his power. Claudius is one of the most all-important(a) characters in Hamlet. He is a character of true power and hatred, who would go to any extreme just to maintain his power and his kingship. His obsession with absolute power is greatly portrayed in Act IV of Hamlet, making it one of the most important and vivid acts in the play.1 Willi am Shakespeare, Hamlet (Toronto Harcourt Brace Company Canada Ltd, 1988), IV.ii. 13, 16-16, 20-22. 2 William Shakespeare, Hamlet (Toronto Harcourt Brace Company Canada Ltd, 1988), IV. i. 31-33. 3 William Shakespeare, Hamlet (Toronto Harcourt Brace Company Canada Ltd, 1988), IV. i. 13 4 William Shakespeare, Hamlet (Toronto Harcourt Brace Company Canada Ltd, 1988), IV. iii. 3-9. 5 William Shakespeare, Hamlet (Toronto Harcourt Brace Company Canada Ltd, 1988), IV. vii. 69-71. 6 William Shakespeare, Hamlet (Toronto Harcourt Brace Company Canada Ltd, 1988), IV. vii. 160-163.

Analysis of Current Event at Telstra Essay Example for Free

Analysis of Current Event at Telstra Essay focus neck is a common phenomenon that an organization attempting to maximize profits must grapple with. Telecommunication as it is the case with Telstra Corporation Limited has been distinguished by highly competitive market. On the same breath, actors and competitors on the market brook been seen struggling with the increasing cost of operation, merchandiseion, development and mature market. In light of this, the corporation faces counselling regaining when it comes to finale do, integrating rising models and molding within the realm of theoretical frameworks. ResearchMoz (2013) cross offs that in an industry where competition is rife, analysis of a companys focusing issues and current events encompass the mention of different strategies that enable it maintain competitive sentiment. Despite these positions, it has to be recognized that analysis of counsel issues of Telstra Corporation Limited must first recognize the p osition of the Company with regard to managing risks as postulated by the Companys Chief Risk Office (Schermerhorn et al., 2014).Ideally, Telstra Corporation Limited has Corporate Social Responsibility (CSR) to go about and as one of its anxiety issue or strategy. Consequently, such must be conceptualised through its laid platform, structure, financial reports and annual reports. Similarly, evidence based researches have shown that the first step in understanding wariness of a company is to integrate its undertaking when it comes to CSR and how sustainable the Company intends to operate with regard to the surround, competitors and specific objectives (Millmore, 2007 Hubbard, 2008 Bardoel, 2012). establish on the Companys Corporate Social Report 2014, its CSR is embedded on four critical issues internal environment, external environment, customers and sustainability (Corporate Social Responsibility Report, 2014). That is, the perpetration of the Company towards corporate responsi bility starts with simple but straight forward commitments that cover its argonas of operations and targeted objectives. From its principled perspective, the primary corporate responsibility chiffonier be summarised as followsProvision of the country a foundation that ensures economic growth, sustainability prosperity, crossroadivity improvement and global competitiveContributing towards resources increasing technology, product function and volume in employment to support the communities in which the Company operates and the specific needs of community at largeGive a leading stewardship of environment by first and importantly, conservation, efficiency in the usage of resources, reducing and maintaining environmental footprint and reduction of operation be (e.g. it took part in the Mobile Phone recycle Program that was co-ordinated by the Australian Mobile Telecommunications Associations (AMTA) (Daley et al. 2014)Based on the Companys corporate social responsibility as one of t he oversight issues and as reported in the article, there is an integration of new focus approach and that is the fact that risk management approach has been tailored to facilitate maximization of profits.Conversely, it can be established, based on its business principles and risk management approaches that the CSR has succeeded in the reduction of any adverse effects on and injury to the environment. Such is as well embedded on the desire to preserve the beneficial qualities of the environment, while ensuring quality products and services in Australia (Baigh, 2014). In addition, to the above principles, analysis of the companys management of this particular issue has also considered profits to the Company thus concluding that Telstra is revamping on this particular management strategy which is succeeding in line with its mulct and long term aims. To conceptualise this argument, scholars such as Hooper and Potter (2006) have drawn a thin line between CSR as a management issue and as a marketing issue. To ascertain that the CSR approach as contextualized is a management issue but financial or marketing issue, in most cases, companies always engage in pricing strategies which also depend on value pricing coupled with strategic markdowns. In such cases, this makes sales of their products to go down since it cannot compete effectively with other products. Additionally, products face what Hamlin (2012) terms as a society of shifting priorities (p.281). Therefore there is pressure to economize up with the emerging social needs by style modification. It is for this reason that any ending to modify must be embedded on the laying claim to meet the needs of the targeted consumers. While the explanation above provides for what would constitute a marketing issue, what Telstra engages in is management issue. According to Johnson et al. (2011), CSR is not only management issue but a current one the sense that it deals with financial performance, top management, ch ief executive and shareholders. Herewith, the management issue within the context of Telstra is the responsiveness that should be taken because in a competitive environment where there are other operators such as Huawei and Vodacom, managers are supposed to intervene in unity with their position and power, especially where management can fail to respond to economic challenges and changes.Also related to CSR as a marketing issue is ethical decision making approaches. According to the article, the process of identification of managing risks through ethical decision making is an integral part of the Companys governance framework and management issue which help in the realization of the success of the strategy as well as financial prospects for future operations. Telstra business ethics entails standards and principles that guide managers, individuals and work group behaviour in line with telecommunication and terms of service in Australia.Additionally, it is important to note that sta keholders of the Company make these conventions (principles) and such have been codified as regulations and laws. Contextualising this definition within the frameworks business management issue ethical decision making help Telstra family design strategies that eliminate misconduct. According to Peng (2014) there are three significant components that sum up its ethical decision making as critical management issue ethical decision making being individual factors, ethical decision making being Companys relationship with others and ethical decision making being opportunities available for the Company. Basically, while this issue might to be seen as revamp on a current management strategy, it has been applied successfully since the Company bases the three components on behaviourist scheme where what matters is what individuals in the Company can do rather than specific quality or attribute. That is, different patterns of individual behaviours are linked to ethical decisions that are do by the Company and such are geared towards the realisation of the goals and objectives that have been set by the Company.To contextualise the success of the Company with its approach of ethical decision making as one the management issue, Perren and Burgoyne (2010) report that Telstra has been engaging with Communication Workers Union with a view to offering better terms of service and transparency in supply management. For instance, in 2013, the Company engaged Low-Income Measures Assessment Committee (LIMAC) (this is an example of Communication Workers Union which is viewed as independent and transparent) which made changes to the package the Company was initially giving to its workers and suppliers. In connection to this, the Company, this particular issue has successful been engaged in what Katzenbach and Smith (2005) term as vertical management (p. 37). Vertical management within the context of ethical decision making is a case where a Company liaises with regulatory organiz ation so as to have a common agenda and conform to the requirements of the industry. Conceptualist theorists and ethical formalism argue that ethical decision making process in management encompass evaluations of fairness product stewardships but with respect to firms overall culture. In summary, with ethical decision making process as one of the management issue, Telstra has a decipherable management and leadership structure which is focused on the achievement of defined objectives including green managements. Lastly, this issue departs from being finance or marketing issue on the ground that the approach lacks market orientation is a model that concretizes the strategy of finance and marketing. Senge et al. (2007) define this theory (market orientation) as a strategy that ensures all products and services as undertaken by Companies are oriented towards specific demands of clients and customers.Still on ethical decision making as one of the Companys management issue or approach, T elstras planning, leading, organising, controlling and functioning is based on choices made on guidelines laid. According to article, one of the important issues to not is that the Companys risk management frameworks are aligned with ISO 31000 Risk Management (Baigh, 2014). While this is an indicator of a management strategy or practice that has succeeded, underpinnings of theories of issue management are significant to the Company additionally technical and commercial objectives remain axis for the Company. The success in management of this issue is conceptualised with regard to audience or customer satisfaction. This is to mean that in as much as its ethical decision making remains a priority as a management issue, targeted markets shapes such prioritiesan tone Aras and Crowther (2009) terms as ascertaining the success of management strategies and policies in downstream and upstream relationships (p. 213).From Michael Patterson (Telstras General Manager for Tasmania) statement on the effective battle the Company had with Optus, it can be realized that the Companys planning, leading, organising, controlling and functioning are in line with the tenet of management of telephone inputs and components that are required in the market. This is an indication that there is long term transparency and conformity to good practices. Assessing Corporate Social Report 2013 vis--vis opening of the chinawares SouFun Sensis, there is evidence that efforts are diverted to supply chain relationships with third party suppliers as well as other competitors. It is important to note that Telstra is overemphasizing on CSR strategies an aspect that may affects its ethical decision making. If this stretches beyond what the Company can handle, strategic alignment with other sectors may be affected. Basically, this is where this strategy differs from the aspect of marketing in the sense that according to the theory of signaling, the best way to market a product is to engage a brand o r product in competitive signal that are intended to pass information to potential consumers with an aim of making such consumers believe that competing products are substandard (Cole, 2012). This is just now how Cadbury for instance has succeeded in capturing the attention of their targeted market every time they engage in marketing. Telstra, through this does management and not marketing as they do not engage in competitive signaling.As a management approach, Telstra looks at ethical decision making differently. That is as a management issue, ethical decision making is seen in terms of transparency when it comes to critical corporate accounting and statements. One of the critical goals of the Company is to attain what it terms as front-line management (Baigh, 2014 p.26). The benefits of the good deal within and around have been necessitated through avoidance of misleading information. The continuum of growth in economy resonates around a transparent business operationwhich is al so a recipe of what this assessment considers to be a successful management approach.Synopsis on the Management IssueFrom the perspective of undertakings in the Company, the aspect is a management issue in the sense that it analyses the environment issues in lieu of external factors that impact business activities. On the other hand, the purpose of the management issues as analysed is to gauge and determinate competitive advantages as well as threats a Company has with regard to its operations. These analyses recognise stiff competitions, threats and opportunities faced by companies such as Optus, Vodafone and 3 Mobile. In as much, this analysis considers Telstra due to its cutting edge when it comes to services such as broadband, hosting, directory and pay TV which are not as large in other companies. Since the management issue has been a success, revamping of a current policy is dickensfold first, there is need to strategize the management issue identified to an effect that th e company benefits from the economies of scales and the strong relationships with suppliers, which will place it in a strong bargaining position with its upstream partners and allows leveraging the costs. Strategizing the management issue to attain this goal means that a focus on customer-relationship and loyalty creation, as well as investment in research and technical development (RD) to reduce the costs of services so as to compete with niche operators. Secondly, revamping on the current management issue must assess the possibility of working alongside its downstream partners to deliver triple-play solutions in voice, data and video services, expansion of data download quotas and continuous innovation in fixed line services, as opposed to agile services, to offer incentives to its clients.Similarly on the question of whether Telstra is handling the identified management issue appropriately is manifold but the assessment will review two issues that offer succinct answers to the q uestion. First, proper management of a company circles around how best a company maximizes a profit and expands networks (ResearchMoz, 2013). Through the management issue, Telstra has leveraged the risks of economic downturns by diversifying its income channels. The growing domestic market and the boost in 4G technologies enable further market penetration and help to reduce the pressure of external factors. Secondly, the Company through the management issue has pursued an investment heavy strategy to grow its existing network. However, financial indicators, outline a challenging internal environment in terms of liquidity and internal funding options.ReferencesAras, G. Crowther, D (2009). Global Perspective on Corporate Governance and CSR.Farnham Gower Pub.Baigh, H. (2014). Seven Strategies for Simplifying Your Organization. Harvard Business Review.Retrieved from http//blogs.hbr.org/2013/05/seven-strategies-for-simplifyi/Bardoel, A. (2012).Tool or duration Thief? Technology and the Work-Life Balance. RetrievedCole, K. (2012). Management Theory and practice. Australia Pearson.Corporate Social Responsibility Report (2014) Understanding the Definition of Corporate SocialResponsibility http//www.telstra.com.au/abouttelstra/download/document/csr.pdfDaley, J., McGannon, C., Ginnivan, L. (2012). Game-changers Economic amend prioritiesfor Australia. Melbourne Grattan Institute from The Conversation, Future of Work https//theconversation.edu.au/tool-or-time-thief-technology-and-the-work-life-balance-8165Hamlin. R. (2012) Towards a Universalistic Model of Leadership a comparative study ofBritishand American empirically derived criteria of managerial and leadership effectiveness. running(a) paper WP005/02, University of Wolverhampton.Hooper, A. and Potter, J. (2006) The Business of Leadership. Aldershot Ashgate PublishingCompany.Hubbard, G. (2008). Strategic management Thinking, analysis, action. Australia Pearson.James, K. and Burgoyne, J. (2001) Leadership Developm ent Best practice guide fororganisations. London Council for Excellence in Management and Leadership.Johnson, G., Scholes, K., Wittington, R. (2011). Exploring schema Text Cases. (9th ed).London Prentice Hall.Katzenbach, J. and Smith, D. (2005) The Wisdom of Teams. New York Harperbusiness.Millmore, M. (2007). Strategic Human Resource Management Contemporary Issues. HarlowFinancial Times, Prentice Hall.Peng, M. (2014). Global Strategy (3rd ed.). Mason, OH South-Western Publishing.Perren, L. and Burgoyne, J. (2010) Management and Leadership Abilities An analysis of texts,testimony and practice. London Council for Excellence in Management and Leadership.ResearchMoz. (2013). Australia Telco company profiles Telstra, Optus and Vodafone.Retrieved from http//www.researchmoz.us/australia-telco-company-profiles-telstra-optus-and-vodafone-report.htmlSchermerhorn, J.R., Davidson, P., Poole, D., Woods, P., Simon, A., McBarron, E., (2014).Management (5th ed.). Australia PearsonSenge, P., e t al. (2007). The dance of change The challenges of sustaining momentum in acquisition organizations. London Nicholas Brealey Publishing.Source document

Planning a Nutritional Education Program

Planning a Nutritional educational activity ProgramNutrition Education leasesMajority of female captives feature the thought of whether they go away have enough victuals for themselves or for their families due to their incarceration. Half of them were incarnated most of their life and did not know what had happened turn out side those walls, so they might not be knowing how to shop and where to abridge viands, lacking the readinesss to cook a meal, and do not know anything about fodder assistance programs (1). They were so used of having hoi polloi to cook for them and because of restricted time they were not able to have much strong-arm activity. The usage of literacy sources such as livelihoodal pamphlets and recipes could enable the prisoners to cultivate a wholesome diet with regular physical activities. Preventing them from any provender-related chronic disease and back up them to maintain a healthy lifestyle. Implementing and developing hindrance that boil do wnes on expertness building and developing healthy lifestyle that incorporate good nutritional practices and physical activity (1). In addition, implementing education program on raft sizes and gram calorie estimation, healthy nutrition purchasing with budget, cooking classes and even food sanitation classes, as well as focusing on healthy eating with a balance diet helps decrease the risk of chronic disease. In summary, a course of instruction for this target population should include lessons on nutrition and childhood nutrition ( component part sizes, nutritional balance and choice of food), skill in relation to cooking, budgeting, purchasing, and preparing (safe food handling practices and procedures), and physical activity habits.Social Cognitive possible actionThe major focus of this nutrition intervention is to apply and develop food management skill and making healthy food choices that include meal schemening, shopping, and with limiting budget. By providing this skill to the female inmates allow and ensure them the skills they privation by following the Social Cognitive Theory (SCT) for behavior change. The implementation of this theory was used by the levelheaded Cents curriculum that will be followed for this nutrition intervention (2). SCT is based on the judgment of having a comfortable learning environment, goal setting, providing opportunities to participate, and skill development to help foster behavior change (2). There argon eight key concepts in SCT which consist of environment, reciprocal determinism, self-regulation, behavioral capability, expectations, self-efficacy, observational learning, and reinforcement (3). In heavy Cents, this program stresses on using educateing lessons in a series to approach in influencing behavior change, providing a comfortable learning environment, dynamic fundamental interaction of the person, by knowing a person knowledge and skill, help individuals to apply with the knowledge, group work is prom oted, and goal setting using the information that argon be introduced during the lesson (4). Participants atomic number 18 express to improve their nutrition and food shopping skills through this program.The main issue with this target population is the lack of knowledge of how to shop and plan a meal with budget. When these female prison inmates are released and re-enter into the high society, they will seek for jobs but with their especial(a) education and low literacy levels the chances of getting employ are swallow (5). Without a job, they will not have enough money to buy food. Therefore, with this program enabling them to plan and shop on budget as yet having a healthy lifestyle.This intervention started with addressing the reciprocal determinism of female inmates participating in sanitary Cents. In Lesson 1 discussed how to make healthy choices on a budget (2). The objectives about this lesson is to allow individual to practice choosing healthier alternatives familiar food and by teaching them the true meaning of healthy foods. The curriculum emphasis on lecturing, focusing on bailiwick, provides information, and asking recall questions, focusing on dialogue learning techniques to generate interest and excitement about the topic lesson (2). Each lesson content activities for the participation to apply, they will be divided into a small group setting to do some group activities such as practicing with the information they learn, food tasting, and goal setting for individual. At the end of the class, the participation get to mint class tips or message handouts and recipe they tried in the lesson.ConceptNeed for Nutrition EducationStrategies for Change in LessonEnvironmentFemale inmates may not have access to healthy and nutritious foods because of where they live, lack of knowledge of what foods are considered healthy, and do not have enough money to buy foods.Provide information on what foods that are healthy, provide resources (MyPlate) and h andouts that are consider healthy foods, and video display ways to shop with budget (L1 -L6)Reciprocal DeterminismMajority of the female inmates that are being release are from low socioeconomic with expressage access to food, limited nutrition education, low literacy which might cause this populations ability to change.Teach about smart shopping for fruits and vegetables (L1), having healthy snacks that they washbasin afford (L2), developing a food budget (L3-L4), educate in planning a meal (L5), and food shopping on a budget (L6). Discuss the importance of these helps them to change the idea that they able to have a healthy lifestyle with a limited budget.Self-RegulationMany inmates who got release currently not practicing healthy eating habits, may need assistance in selecting appropriate goals, problem solving, monitoring, and even decision making.Aid with goal setting, problem solving, and decision making by encouraging the participants to take home handouts and recipes (L1-L 6). Also, bring forward participants to use what they learned and participate in the discussion concerning their goals and decision (L1-L6).Behavioral CapabilityPrisoners need the knowledge and skill to manage their food aft(prenominal) they are release, so they need assistance and education on how to prepare healthy meals with alternatively cheap healthy food options.Provide information and reflection on how to shop and plan healthy meals and snacks in way that is easy to follow (L1, L2, L4-L6).ExpectationsWhile many female inmates may know that fruits, vegetables, whole grains are healthy for them, they may not believe that is impossible for them to purchase healthy items with low budget.Introduce impudent ways to purchase healthy food options and encourage participants to try new recipes. Handouts and recipe sheets will be provided additional information and ideas to try after the lessons (L1-L6).Self-EfficacyThe target population may not live at the area where they are good access to grocery store, therefore, they may not try before some of the foods.Promote and motivate the participants in trying new foods and make some changes with their diets. Handouts and recipe provided with additional recipe of trying other food options. (L1-L6)Observational LearningInmates are being confined with other prisoner in the cells so they often talked and learned from each other.Lessons are taught through observational learning that involved group problem-solving discussion, listening, seeing, hearing and even asking can engage in and to promote understanding to participants (L1-L6)ReinforcementsThe target populations may not implement on healthy meals option because after they are released the chances of them getting employed are low (5) therefore lack of financial resources which lead to limited access to healthy food.Having low-income which eligible them to participate in food assistance programs. depose the participants about food assistance programs can help the m to access and choose foods with higher nutritional quality (L3).CurriculumThe Healthy Cents program in an telephone extension of Food accompaniment Nutrition Education (FSNE) by University of Maryland. It is published in the year 2015 and is funded by United States Department of Agricultures SNAP-Ed. This curriculum is designed for adults, parents/fathers/mothers with low-income individuals and families who have limited food resources, limited budget to purchase and prepare healthy food at home. This program combines nutrition education and food resource management principles to encourage limited resource families to make healthy food choices that include making healthy choices on a budget, decreasing food expenses, developing a food budget, planning a meal, and food shopping on a budget (6). The curriculum links tools and methods for improved food resource management with USDA nutrition messages to stretch food dollars and encourage healthy food choices using MyPlate (6). Thes e lessons were developed using the Social-Cognitive Theory. The program was created to last for 60 minutes per lesson and with the total of 12 lessons. The lesson will be started off with the whole group then will be divided into smaller group of 4 participants each for discussion and activities.Educators able to easily follow along with the lesson plans because it is well-organized format. In the curriculum, there are handouts for the educators about materials that they need and things that are require for each lesson. There is a free downloadable file called Healthy Cents from the USDA website with all the complete information needed to facilitate the lessons. The lesson will inform about who, why, lesson length, where, and what about each topic, materials and supplies that are needed for the class, things to say and side notes for the educators, discussion questions for the participants, activities that will be doing for each lesson, new recipe to try, as well as handouts for the learners.After taking a sample handout from the take home tips, the handout was found to be a 4.3 Flesch-Kincaid Grade Level on Microsoft Word. However, not all handout contains the same literacy level. One of the handout has a grade level of 8.9. Some of the handouts are appropriate yet some is not appropriate for the target population, because with their limited education and low literacy levels (5) and about 68% did not receive high school diploma (7), it will be hard for them to comprehend the harder and higher literacy information on their own.It is important to point out that Healthy Cents contain total of 12 lessons in the curriculum. In this assignment, it will be shorten to 6 lessons that are relevance to this target populations needs. Everyone is provided with a written matter of handout about the lesson and recipe to bring home with them.Lesson 1 Making Healthy Choices on a Budget. The first lesson stresses the importance about what is healthy food using MyPlate poster and how to afford and shop smartly for fresh produces. The major goal is to able to choose healthier alternatives to familiar foods and able to identify divers(prenominal) ways to buy fresh produce using coupons and with limited budget.Lesson 2 Decreasing Food Expenses. The objective of this lesson is to help individual or families to buy healthy snacks that are affordable. Participants will compare the cost of buying individually packaged snacks to bulk package, make their own snacks and understand that snacks can be affordable to do at home and healthy. they will also practice to read nutrition facts labels to identify healthy foods.Lesson 3 Developing a Food Budget. This lesson is intended to teach the participants to choose between food needs and food wants also developing a plan on estimation food expenses. The participants will learn the 5 food groups that made up of a healthy plate and learn to plan for monthly food budget. They will play a board zippy that related to the lesson and try some new food that they can make for themselves.Lesson 4 Community Food Assistance Programs. Participants will have the opportunity to get resources and examine the food assistance programs that are available in the community. course session saving money using coupons to purchase healthier items.Lesson 5 Planning a Meal to Make Life Simpler. This lesson will allow the participants to know the benefits of meal planning and acquire skills needed for developing a weekly meal plan. The learners will taste a healthy recipe that is simple to prepare.Lesson 6 Food Shopping on a Budget. Participants will learn about shopping strategies Practice using unit price compare to prices at the grocery store. Explore the layout of a grocery store and how to find lower cost items by looking for at the products on shelves below eye level. Ask the participants to choose one new strategy to try for saving money at the grocery store.This curriculum is quite complete, however there is a g ap in the program. The involvement of others who have chronic disease in the program will face challenges. As we know, from the nutrition assessment that there are quite many of inmates have chronic disease due to the foods being served in the prison and lack of physical activities, therefore some might face the challenge of health-related nutrition concerns. They do not have the knowledge on what kind of food and nutrition that beseeming the needs of their body. Perhaps modifying the intervention to involve lesson on obesity, malnutrition, diabetes, and other chronic diseases that require certain kind of foods and provide alternative food options to help lower health risks that would make it more complete.Other Program ComponentsAs the target population focuses on female inmates, it is important to consider a wider age range. This intervention educates on budgeting and how to shop with limited resources. It educates and incorporation of knowledge for healthy food options. It shows about meal planning and budgeting shopping, however it did not educate about portion sizes. American food culture is well known for big portion they might have calculated and plan their meal but without the proper portion sizes will cause them to over eat which will lead to overweight and obese. Other than portion size, providing hands-on approach and educating on how to prepare meals will have beneficial to the target population.In addition, studies have showed that female inmates must overcome their unique social, mental, emotional, and physical challenges that prevent their ability to blend smoothly back into the society (8). Therefore, emphasis on discussing healthy lifestyle choices and habits for individual or families to create an environment that allows for positive behavior change (8) is extremely important to this population.References Decker, Jennifer and Dharod, Jigna. Nutrition Education Needs of Women Being Released from Prison. Maine Nutrition Network, USM. USDA, Foo d Stamp Nutrition Education, 2006. Website. Available at https//snaped.fns.usda.gov/snap/resourcefinder/WomenReleasedFromPrison.pdf. Accessed March 1, 2017.Boyle Marie A. Community Nutrition in Action An entrepreneurial Approach 7th ed. Boston, MA pp 87. Textbook. Published 2016. Accessed March 25, 2017.United States Department of Agriculture. Healthy Cents. 2015. Website. Available on https//snaped.fns.usda.gov/materials/healthy-cents. Accessed on March 26, 2017.Astray-Caneda, Vivian, Busbee, Malika and Fanning, Markell. Social Learning Theory and Prison Work Release Programs. Florida International University, USA. 2013. Website. Available at http//digitalcommons.fiu.edu/cgi/viewcontent.cgi?article=1165context=sferc. Accessed March 26, 2017Learning to Shop Wisely for Nutritious Foods Makes Healthy Cents. Food Supplement Nutrition Program. University of Maryland Extension. 2017. Website. Available at http//extension.umd.edu/fsne/fsne-adult-programs/learning-shop-wisely-nutritious-fo ods-makes-healthy-cents. Accessed March 26, 2017.Harlow, Caroline Wolf. Ph.D. BJS Statistician. Education and Correctional Populations. Bureau of Justice Statistics. Revised January 2003. Website. Available at https//www.bjs.gov/content/pub/pdf/ecp.pdf. Accessed March 27, 2017.Reentry Programs for Women Inmates. Washington, DC U.S. Department of Justice, National Institute of Justice. Journal Issue No. 252. June 2003. Website. Available at https//nij.gov/journals/252/Pages/reentry.aspx. Accessed March 26, 2017.

Neuroscience, Psychotherapy and Neuropsychotherapy

Neuroscience, psychotherapeutics and Neuro psychotherapeuticsToni KillinTherapeutic strategies have been built from hundreds of years of experience. These strategies have over time proven their effectiveness for exceptional problems (Cozolino, 2010) (Grawe, 2007). The house of Neuroscience looks at superstar structures and functions it is a large field encompassing neurobiology, neurochemistry and areas of psychology. Neuro mental hygiene blends the fields of neuroscience and psychotherapy together. The emphasis being driftd on the neuroscientific foundations of psychotherapy. Present central neuroscientific research findings offer psychotherapy scientific support, putting forward a new and fresh perspective for therapists. Neuropsychotherapy tries to remove the invisible barrier between learning ability and brain (Cozolino, 2010) (Grawe, 2007). Both the mind and brain are equally important, focusing on either one at the cost of the other would be to morsel of events as if o ne is irrelevant (Cozolino, 2010). My contact with clients and professionals much(prenominal)(prenominal) as therapists, psychiatrists and psychologists led to my interest in Gestalt Therapy. Although my training in Gestalt Therapy is a passion, the journey has been a severe learning experience. The experiential nature of Gestalt therapy has proven difficult for me to internally intellectualize. It has been this difficulty that led me to readings on neuroscience, as a way to understand, more fully, the mechanisms behind psychotherapy in general, in particular experiential modalities. These modalities reflecting good successes in areas that other modalities were appearing to be only mildly successful (Cozolino, 2010)(Grawe, 2007). I see this as an opportunity to have a deeper and different perspective on the therapeutic process and the therapeutic relationship.Consequently, this literature review entrust be divided into leash sections. The first will give a rudimentary overview of what neuroscience is and the emergent findings within this field of psychotherapeutic interest.I will then relate neuroscientific findings broadly to the field of psychotherapy. Subsequently, I will relate some of these findings to some of the methodologies of Gestalt Therapy bringing findings from neuroscience together in the therapeutic relationship with a view to seeing Gestalt Therapy and psychotherapy in general from new and helpful vantage points.Given that neuroscience is a diverse field encompassing many professions, it is important to make the distinction that this paper will look at neuroscientific findings only in the context of psychotherapy and neuropsychotherapy. There are standardised professional differences not covered as part of this paper between clinical neuropsychologists, clinical neuropsychotherapists and psychotherapists that have good companionship of areas of neuroscience that are of interest to the modality that they practice.Neuroscience is a complex a rea of study to define it holds its place within all the sciences that deal with the nervous system such as Neurobiology, Neurochemistry, Neuropharmacology and Neuroanatomy. Neuroscience likewise draws on the knowledge found within many of the traditional disciplines such as Biology, which looks at the living matter in all its forms and phenomena. Biochemistry, the chemistry of living matter. Physiology a branch of biology that deals with functions and activities of living organisms. Pharmacology that delves into the preparation, uses and effects of drugs and data-based Psychology which uses experimental methods to study mental and emotional activity in animals and humans (What is Neuroscience, 2012) (dictionary.com),(Stonehill College, Congregation of the Holy Cross, 2014).Neuropsychotherapy (NPT) is a term used to condense and combination neuroscientific knowledge in a variety of applications and treatments (Neuropsychotherapy.org, 2014). Neuropsychotherapists come from a wide r ange of medical and therapeutic backgrounds. A neuropsychotherapist is aware of the body-psyche interaction and uses their training and knowledge to carry out therapeutic assessments and treatments.Recent discoveries show that our experiences channelize the shape of our brain. Individual areas grow or change by adding miniscule amounts of the brain spooky circuitry and eliminating old ones(Aherne, 2012). Knowledge such as this will help the evolution of more effective therapies, healthier connections will further recovery. This type of thinking challenges the metaphors of the past, visually perceiving brains as machines. Analogies made for computers with references to fixed circuitry and hardwiring (Doidge, 2011). Moving beyond the 20th century where the brain was modelled as a static perspective, we now see the brain as infinite in complexity. Essential regionalised connections are well distributed and integrated throughout the brain. Functions that were thought to be only in loc alised areas, now are cognize to participate with other parts of the brain(Fialkoff Jones, 2010) . New research includes exploring the interaction between neurochemical transmitters and brain cells, feel at previously unknown functions of neurons and glials, the most common cells in the brain(Fialkoff Jones, 2010) . There are four principles that become apparent to our intellect of the brain centers. The brain is complex, connected, adaptable ( malleable) and evolved. The brain is adaptive, constantly rewriting itself. This ability to grow and change is referred to as plasticity. The brain not only creates new connections and develops greater physical space based on need, it also has the ability to erase old and impertinent connections (Doidge, 2011). The notion of a brain that can re-design its own form and function through thought and activity is profound. This is amongst the foremost important alterations of the brain since our understanding of grassroots anatomy and the f unctioning of its most elementary component, the neuron(Doidge, 2011). Like all revolutions, this has profound effects. The neuroplastic revolution has many implications, all areas that trade with human nature, such as our understanding of relationships, addictions, culture, learning and psychotherapies all change our brain. The humanities, social and physical sciences will all have to come to terms with the fact of the self changing brain. From psyche to person the brains architecture is unique and changes the course of individuals lives (Doidge, 2011). One of neurosciences most extraordinary discovery is that thinking, learning and acting can turn our genes on or off, thus sharpening our brain anatomy and our behaviour (Doidge, 2011). Brain plasticity is a very general term, applied to all ways that the brain is flexible and can process training in different ways (Buczynski,). A simplified example of steps in neural plasticity would begin with an inability in neurological functi oning, this would offer to the founding of a secondary route. With use this secondary route finds shorter pathways and gets quicker and better at using these secondary neural pathways. With prolonged use and characterisation these pathways continue to strengthen (Doidge, 2011). In the brain, there is an optimal point of plasticity at moderate ranges of arousal. Neural growth hormones and many of the processes that stimulate plasticity turn off at low levels of arousal, turn on at moderate levels, and turn off again at high levels (Buczynski,). This is important information when looking at encouraging new neural pathways. Creating an experience in therapy that results in neuroplasticity are to some degree a marker of successful therapy(Buczynski,). Another openhanded discovery in neuroscience that is still getting attention is that of mirror neurons.mirror neurons are smart cells(reference) laying down inner depictions within our brain and possibly our bodies. Mirror neurons permi t us to comprehend the actions, intentions and feelings of others. These neurons, held in many parts of our brains, fire not only when we perform an action, such as holding hands, but also when when see others perform actions. Mirror neurons are not limited only to action, they are also stimulated when we experience an emotion and when we visually perceive others experiencing an emotion, such as pleasure, sorrow or distress(Lacoboni, 2008). Within the neuroscientific community mirror neuron research in humans has been polemic, no one piece of evidence being categorically accepted as proof that mirror neurons exist within humans. This however does not detract from the plethora of evidence supporting mirror neurons in humans (Keysers Gazzola, 2010) given technological reasons have thwarted the finding of individual mirror neurons (Vivona, 2009) supporting evidence has come from the electroencephalogram (EEG) recordings, behavioural experiments and transcranial magnetic remark (TMS) studies (Keysers Gazzola, 2010). In short research has shown that mirror neurons exist somewhere in the human brain and are not restricted to premotor and inferior parietal cortex. interrogation has also shown that certain neurons appear to have anti-mirror properties. When these neurons work in combination with mirror neurons they could help the brain perform internal simulations of other concourses actions, simultaneously selectively blocking explicit motor output and remove ambiguities from who performed the action (Gallese, 2008) (Keysers Gazzola, 2010).Implications in psychotherapyNeuroplasticity does not always espouse uplifting news our brains may be more resourceful, but are also more susceptible to outside impacts . Neuroplasticity can produce more flexibility, but also more rigid behaviours, this is called the plastic paradox(Doidge, 2011, p. 6), some of our most tenacious habits and disorders are products of plasticity. Once a particular plastic change occurs and beco mes well established, it can prevent other changes from from occurring. Considering some(prenominal) the positive and negative properties of plasticity help us understand the extent of human possibilities (Doidge, 2011).In text referenceBibliography Neuropsychotherapy.org. (2014). NPT Neuropsychotherapy. online Retrieved from http//www.neuropsychotherapy.org/index.html Accessed 14 Apr 2014.ReferencesAherne, D. (2012). Medication or psychotherapy in the treatment of depression and anxiety. Retrieved from http//inside-the-brain.com/tag/dr-declan-Buczynski, R. (). The Neurocience of Psychotherapy, transcript of a teleseminar session, Louis Cozolino, PhD, conducted by Ruth Buczynski, Phd of NICABM./Interviewer Ruth Buczynski. The National Institute for the Clinical Application of Behavioral Medicine, www.nicabm.com.Cozolino, L. J. (2010). The Neuroscience of Psychotherapy Healing the Social Brain (2nd ed.). 500 Fifth Avenue, New York N.Y. 10110 W.W.Norton Company Inc.Doidge, MD, N. ( 2011). The brain that changes itself, stories of personal triumph from the frontiers of brain science. Retrieved from http//www.slideshare.net/krishnamohangorle/thebrainthatchangesitselfFialkoff, L., Jones, N. (2010). Brain based research, overview of recent neuroscience. Retrieved from http//www.slideshare.net/Lfialkoff/brain-based-research-overview-of-recent-neuroscienceGallese, V. (2008, September). Empathy, corporate Simulation, and the brain Commentry on Aragno and Zepf/Hartmann. American Psychoanalytical Association, 56(3), 769-81,803,805-9. http//dx.doi.org/10.1177/0003065108322206Grawe, K. (2007). Neuropsychotherapy How the Neurosciences Inform Effective Psychotherapy. 270 Madison Avenue New York, NY 10016 Mahwah Routledge Member of the taylor and Francis Group.Keysers, C., Gazzola, V. (2010, April 27th). Social Neuroscience Mirror Neurons Recorded in Humans. Current-Biology, 20(8), 353-354. http//dx.doi.org/http//dx.doi.org/10.1016/j.cub.2010.03.013Lacoboni, M. (2008). M irroring people The New Science of How We Connect With Others. In Mirroring People The New Science of How We Connect With Others. Retrieved from http//online.wsj.com/news/articles/SB121191836113423647Stonehill College, Congregation of the Holy Cross. (2014). What is Neuroscience. Retrieved from http//www.stonehill.edu/academics/areas-of-study/neuroscience/what-is-neuroscience/.Vivona, J. M. (2009, June). Leaping from Brain to Mind a Critique of Mirror Neuron Explanations of Countertransference. Journal of the American Psychoanalytical Association, 57(3), 525-550. http//dx.doi.org/10.1177/0003065109336443What is Neuroscience. (2012). Retrieved April 16, 2014, from http//www.medicalnewstoday.com/articles/248680

Comparison of Techniques for Diagnosis of Multiple Sclerosis

Comparison of Techniques for Diagnosis of Multiple SclerosisBackground There is change magnitude need to develop specific biomarkers for multiple sclerosis (MS) to aid in the diagnosis, improve the management of patients and the monitoring of the effectiveness of treatment. Oligoadenylate synthetase 1 (OAS1) is up regulated by type 1 interferon. A single nucleotide polymorphism (SNP) in exon 7 of OAS1 results in differential enzyme activity. Objective To correlate different OAS1 genotypes, in patients with relapsing remitting multiple scleroses (RRMS) under interferon-beta (IFN ) therapy, with disorder activity. Subjects and Methods OAS1 genotype was assessed in 20 patients with RRMS and 20 age and gender matched healthy controls. All patients were medicated with IFN . The patients were subdivided in terms of illness activity assessed by Expanded Disability Status Scale (EDSS), in two groups group I with minimal disease activity and group II with severely active disease. All patie nts were followed up every 6 months for a period of 2 years. Results Genotyping analysis of the OAS1 gene revealed a significant difference amongst RRMS patients and control group, with lower frequency of GG in patients (25%) comp ared to controls (65 %) (p = 0.0001). Furthermore, AA genotype was detected 35% of patients compared to 0% in controls (p = 0.01). Regarding disease activity, AA genotype had a significantly higher frequency (71.4%) in patients with severely active disease compared to 15.4% in patients with minimally active disease (p=0.0001). Conclusions The A-allele is considered risky and the G is protective, so those with the AA genotype in particular should be carefully monitored for evidence of disease activity. Conversely, GG genotype may protect against increased disease activity.IntroductionMultiple sclerosis (MS) is an inflammatory demyelinating disease of the central flyaway system, the etiology and pathogenesis of which remain largely elusive. The most common form of MS is the relapsingremitting form (RRMS), in which episodes of acute worsening of neurological function (relapses) are followed by partial or complete recovery periods (remissions) free of disease progression.1,2Type 1 interferons (IFNs) are innate immune cytokins that activate the JAK/Stat mansion pathway leading to induction of IFN-stimulated genes. The 2,5-OAS family is central to the IFN antiviral pathway for computer viruses whose replication includes production of double-stranded RNA. One member of this family of proteins, OAS1, induces RNAseL, resulting in degradation of viral RNA, inhibition of virus replication, and promotion of cellular apoptosis.1Several OAS1 polymorphisms generate been reported one located at the exon 7 splice-acceptor site results in alternative splicing of the OAS1 mRNA. Although clinical trials have proven the efficacy of interferon-beta (IFN ) in the treatment of RRMS2-4, over one-third of patients have continuing significant disease activ ity.5 On purely clinical grounds, patients have variously been considered to have responded poorly, based on relapse occurrence6-9 or on disablement progression while receiving IFN therapy.10 Therefore, cohorts of patients receiving IFN can be informative for evaluating general determinants of disease activity.Aim of work to examine the relationship between OAS1 genotype and indices of disease activity in RRMS under IFN therapy.Subjects and MethodsTwenty patients with RRMS according to revised McDonald criteria11 were enrolled from an outpatient and inpatient cosmos attending Neurology Department, Tanta University Hospital. Twenty unrelated age- and gender-matched volunteers, with no history of MS or other neurologic disease, were recruited as a control group. All patients certain IFN therapy and followed up every 6 months over a period of 2 years from January 2010 to January 2012. The Ethics Committee of Hospital approved the study, and a written advised consent was obtained from each participant.For all patients, baseline data collected included disease duration, age at onset, relapse history prior to therapy, and clinical disability measured using the Expanded Disability Status Scale (EDSS).12 Relapses were defined as an episode of neurologic disturbance lasting for at least 24 hours and not caused by a change in core body temperature or infection.13 Disability progression was defined as an increase in EDSS pee-pee by 1 point from baseline confirmed at 6 months.5Genomic DNA was isolated from peripheral blood samples. Primers were designed to specifically amplify a 347-bp product surrounding the rs10774671 SNP. A total of 5 grams of genomic DNA was amplified by PCR. Primer sequences used were rs 10774671 forward, TCCAGATGGCATGTCACAGT and reverse, AGAAGGCCAGGAGTCAGGA.Amplification conditions included initial denaturation at 94 centigrade for 2 minutes, followed by 28 cycles at 94 centigrade for 20 seconds, 62 centigrade for 40 seconds 72 centigrade f or 30 seconds, with a final extension for 7 minutes at 72 centigrade. The PCR products were digested with the ALU1 restriction enzyme. Digested products were analyzed by agrose gel electrophoresis and genotypes were assigned, the A-allele coding for a truncated form with low activity and the G conferring high enzymatic activity.Patients were assigned to 1 of 2 groups. Group I included minimal disease activity patients who experienced a maximum of 1 relapse aft(prenominal) 24 months of IFN therapy and had no sustained disability progression. Group II included a severely active disease patients who had 2 or more relapses on IFN therapy over 24 months with or without sustained disability progression.14Statistical AnalysisSPSS 10 was used for data analysis.15 P value

Personal Narrative: Lost Wallet Essay examples -- essays research pape

A wallet, or purse for some, is a precious item in which virtually people carry things more essential than money towards e trulyday life. If some people were to lose that portable safe, they may be offset for the rest of that day. The soul without that wallet could be upset and depressed for awhile. Maybe something of great special value was in that wallet. This person could have these feelings for a long time, until they find their place by which case they are filled with joy. I, personally, keep anything I may have interest in knowing where it is, in my wallet. I am very good about always having my wallet and never losing it...until recently.In my wallet, I store very personal items such as my license and some pictures. Among some former(a) things, I have my money, like everybody else, and gift certificates for stores. This summer, I went to Danville, Kentucky with my family. I drove down there with my wallet and took it everywhere with me, like I would any other time. Well, wh en someone doesnt have pockets, then it is hard to keep their wallet right next to them at all times. I was ca...

Career Essay -- Essays Papers

Career Essay magnetic declination ManagementFor the longest time I could not decide on a major and a career to study throughout college. When I came to Georgia Southern University I discovered that they had a major that was very raise to me. Sport Management id the ideal major for my interest and me. Since I love sports I figured that this would be the career for me. A degree in Sport Management helps to prepare for success in sport related occupations. The job market varies in the field of sport management. Some occupational opportunities include gymnastic trainer, coach, sports official, Sports agent, camp director, sporting goods sales/dealer, pro scout, athletic director, sport promoter. The list can go on of the opportunities in this career. Mostly anything sport related in today...